==== Mutagenesis ==== 1) Design the mutagenesis primers (fwd and rev) with 15-18 bp each side of the mutated codon Ex : Carm1 P409A Primer fwd TGGCTATCCACAGCCGCAACAGAGCCCCTGAC Primer rev GTCAGGGGCTCTGTTGCGGCTGTGGATAGCCA 2) PCR : * 1 µl plasmid DNA (200ng/µl) * 5 µl 10x pfu buffer * 5 µl dNTP 2mM * 5 µl DMSO * 0.5 µl primer fwd 100µM * 0.5 µl primer rev 100µM * 1 µl pfu polymerase * qsp H2O 50 µl Cycles : 20x(94°C 30’’, 55°C 30’’, 68°C 20’) 3) Digest //Dpn//I : add 6 µl tampon 4 Biolab’s + 4 µl //Dpn//I 2h 37°C. 4) Transform DH5a with 10 µl. Spread on LB+AB plate.