https://bsi.inscog.eu/ 2026-06-01T23:07:17+00:00 https://bsi.inscog.eu/ https://bsi.inscog.eu/lib/exe/fetch.php?media=wiki:dokuwiki.svg text/html 2023-11-01T20:18:58+00:00 Anonymous (anonymous@undisclosed.example.com) https://bsi.inscog.eu/doku.php?id=cloning:gatc&rev=1698869938&do=diff GATC Biotech – Information Please find below the sample preparation instructions to perform your sequencing in an optimal way with GATC Biotech SUPREMERUN tube Accepted starting material * Plasmid DNA * PCR fragments Sample requirements text/html 2023-11-01T20:18:58+00:00 Anonymous (anonymous@undisclosed.example.com) https://bsi.inscog.eu/doku.php?id=cloning:mutagenesis&rev=1698869938&do=diff Mutagenesis 1) Design the mutagenesis primers (fwd and rev) with 15-18 bp each side of the mutated codon Ex : Carm1 P409A Primer fwd TGGCTATCCACAGCCGCAACAGAGCCCCTGAC Primer rev GTCAGGGGCTCTGTTGCGGCTGTGGATAGCCA 2) PCR : * 1 µl plasmid DNA (200ng/µl) text/html 2023-11-01T20:18:58+00:00 Anonymous (anonymous@undisclosed.example.com) https://bsi.inscog.eu/doku.php?id=cloning:slic_cloning&rev=1698869938&do=diff SLIC Cloning * Digest and gel-purify the vector. * PCR amplify the insert with 20-30 pb sequence overlap with the vector sequence (use Phusion polymerase) and purify the PCR product (after agarose gel or DpnI digestion) * Mix 100 ng vector with 200 ng insert, add 1 µl BioLab's buffer 2.1, 0.5 µl T4 DNA polymerase, qsp H2O 10 µl. Incubate 3-4 minutes at room temperature. Stop the reaction on ice.